Hey Guys,

TLRT: How do I get sgRNA into CAS 9, then CAS 9 into E. coli?

I'm kinda new here, but i'm looking for some help.

I am trying to design a CRISPR knock-out protocol for my undergrad Biotechnology class to use so they can get some experience using CRISPR.

Basically what we are doing is the run of the mill pGLO transformation on E. coli, grow them on NA plates with Ampicillin in it, then try to knock out the Ampicillin resistance gene (AmpR) out of the plasmid with CAS 9. Once that is done we're going to stain the live and dead cells using Fluorescein Diacetate (live cells) and Trypan Blue (dead Cells). We are also looking for a fluorescent antibody that will bind to the CAS protein, so we can confirm that the cell dies while also having the CAS protein inside.

What I, and my professor/PI, is getting hung up on is how do we get the sgRNA for the sequence we are trying to knock out into the CAS protein, and then how can we get that CAS Protein into the E. coli Cell? I know there are plasmids I can buy that allows the cell to express the CAS protein, but how can we specify the CAS protein to the sequence we want it to edit. We've tried they Synthego design tool, and CHOPCHOP but we've hit brick walls with both. Any and all help is super appreciated. If anyone is interested the sequence of the AmpR is down bellow, i'm also having trouble designing sgRNA for that since it isn't in NCBI lol!

TACTCATAAGTTGTAAAGGCACAGC

GGGAATAAGGGAAAAAACGCCGTAAAACGGAAGGACAAAAACGAGTGGGTCTTTGCGACCACTTTCATTT

TCTACGACTTCTAGTCAACCCACGTGCTCACCCAATGTAGCTTGACCTAGAGTTGTCGCCATTCTAGGAA

CTCTCAAAAGCGGGGCTTCTTGCAAAAGGTTACTACTCGTGAAAATTTCAAGACGATACACCGCGCCATA

ATAGGGCACAACTGCGGCCCGTTCTCGTTGAGCCAGCGGCGTATGTGATAAGAGTCTTACTGAACCAACT

CATGAGTGGTCAGTGTCTTTTCGTAGAATGCCTACCGTACTGTCATTCTCTTAATACGTCACGACGGTAT

TGGTACTCACTATTGTGACGCCGGTTGAATGAAGACTGTTGCTAGCCTCCTGGCTTCCTCGATTGGCGAA

AAAACGTGTTGTACCCCCTAGTACATTGAGCGGAACTAGCAACCCTTGGCCTCGACTTACTTCGGTATGG

TTTGCTGCTCGCACTGTGGTGCTACGGACGTCGTTACCGTTGTTGCAACGCGTTTGATAATTGACCGCTT

GATGAATGAGATCGAAGGGCCGTTGTTAATTATCTGACCTACCTCCGCCTATTTCAACGTCCTGGTGAAG

ACGCGAGCCGGGAAGGCCGACCGACCAAATAACGACTATTTAGACCTCGGCCACTCGCACCCAGAGCGCC

ATAGTAACGTCGTGACCCCGGTCTACCATTCGGGAGGGCATAGCATCAATAGATGTGCTGCCCCTCAGTC

CGTTGATACCTACTTGCTTTATCTGTCTAGCGACTCTATCCACGGAGTGACTAATTCGTAACCATT (861 bp)